MethanoGram

Predicts culturing conditions of methanogens using random forests and n-gram analysis. MethanoGram is build using data from PhyMet2, a database of the methanogenic bacteria.

Usage: upload 16S rRNA or mcrA nucleotide sequences of an unknown methanogens and press “Submit” button. The results are predicted culturing conditions. Sequences may be submitted directly or as .fasta files. The accuracy of predictions depends on the input sequence used. Consult the Average error panel to see which type of sequence yields the most precise information on parameters of your interest.

For more information consult the manual.

Restrictions:

  • Be patient - computations can take up to few minutes.

Author: Michal Burdukiewicz.

Example 16S rRNA sequences:

>Methanobacterium aarhusense, 16S rRNA
gtaacacgtggataacctacccttaggactggtataaccccgggaaactggggacaatcccagatatgtgaagattcctggaatggtccttcactcaaatgctccggcgcctaaggatggatctgcggccgattaggttgttggtggggtaaaggcccaccaagccgataatcggtacgggttgtgagagcaagagcccggagatggaacctgagacaaggttccaggccctacggggcgcagcaggcgcgaaacctccgcaatgcgagcaatcgcgacgggggaaccccaagtgccactcttaacggggtggcttttctgaagtgtaaaaagcttcaggaataagggctgggcaagaccggtgccagccgccgcggtaacaccggcagctcaagtggtggccgtttttattgggcctaaagcgttcgtagccggcctgataagtctctggtgaaatcctgcagcttaactgtgggaattgctggagatactatcaggcttgaggtcgggagaggttagaggtactcccagggtaggggtgaaatcctgtaatcctgggaggaccacctgtggcgaaggcgtctaactggaacgaacctgacggtgaggaacgaaagccaggggcgcgaaccggattagatacccgggtagtcctggccgtaaacgatgtggacttggtgttgggatggcttcgagctgctccagtgccgaagggaagctgttaagtccaccgcctgggaagtacggtcgcaagactgaaacttaaaggaattggcgggggagcaccacaacgcgtggagcctgcggtttaattggattcaacgccggacatctcaccaggggcgacagcagaatgatggccaggttgacgaccttgcttgacaagctgagaggaggtgcatggccgccgtcagctcgtaccgtgaggcgtcctgttaagtcaggcaacgagcgagacccacgcccttagttaccagcggatcctttcaggatgccgggcacactaaggggaccgccagtgataaactggaggaaggagtggacgacggtaggtccgtatgccccgaatcccctgggcaacacgcgggctacaatggctaggacaatgggttccgacaccgaaaggtgaaggtaatcccctaaacctagtcttagtccggatcgagggctgtaacccgccctcgtgaagctggaatgcgtagtaatcgcgtgtcataatcgcgcggtgaatacgtccctgctccttgcacacaccgcccgtcacgccacccaaaaagggtttggatgaggctttaatcttaggttaaggtcgaatctgggttctttgaggagg

>Methanobacterium palustre, 16S rRNA
tccgtttgatcctggcggaggccactgctattgggtttcgattaagccatgcaagtcgtacgattcctttcggggngtcgtggcatacggctcagtaacacgtggataacctacccttaggactgggataaccccgggaaactgggnataataccggatatgtggagatacctggaatggtacttcattgaaatgtattcgtgcgcctaagnatggatctgcggnagattaggtagttggcggggtaaatgcccaccaagccagtaatctgtacgggttgtgagagcaagagcccggagatggaacctgagacaaggttcnaggccctacgggnngcagcaggcgcgaaacctccgcaatgcacgaaagtgcgacgggggnaacccaagtgccactcttaacggggtggcntttcttaagtgtaaaaagcttttggaataagagctgggcaagaccggtgccagccgccgcggtaacaccggnagctcaagtggtggnnatttttattgggcctaaagcgttcgtagccggtttgataagtctctggtgaaatctcacggcttaaccgtgagnattgctggagatactattaggcttgaggccggnngaggttagcggnactcccagggtaggggtgaaatcctataatcctggnnggaccacctgtggcgaaggcggnnaactggaacgnncctgacggtgagtaacgaaagccaggngcgcgaaccgnattagatacccgggtagtcctngccgtaaacgatgtggacttggtgttgggatggctccgagctgccccagtgccgaagggaagctgttaagtccaccgcctgggaagtacggtcgcaagactgaaacttaaaggaattnnnnnnnnagcaccacaacgcgtggagcctgcggtttaattggannnaacgccggacatctcaccaggggngacagcagaatgatagccaggttgatgaccttgcttgacaagctgagaggaggtgcatggcngccgtcagctcgtaccgtgaggcgtcctgttaagtcaggcaacgagcgagacccacgcccttagttaccagcggatccttcgggatgccgngcacactaaggnnaccgccagtgatnaacnggaggaaggagtggacgacggnaggtcngtatgccccgaatcccctggnctacacgcgggctacaatggctaggacaatgggttccgacactgaaaagtgaaggtaatctcctaaacctagccntagttcggattgagggctgtnactcgcccncatgaagctggaatgcgtagtaatcgcgngtcataaccgcgcggtgaatacgtccctgctccttgcacacaccgnccgtcacgccacccaaaaagggtttggatgaggccctagtctttgttggttagggtcgaatctgggttctttgaggagggc

Example mcrA sequences:

>Methanobacterium aarhusense, mcrA
ctgttatcgtaggtctaaacaccgcacatactgttatcgagaaaaggttaggtaaagaagttacacctgaaaccataactcattaccttggaaactgtaaccacgcaatgcctggtgcagcagttgtacaagaacacatggtggaaaccaacccatcacttgtggctgacagttatgtgaaaatattcactggtaatgatgaaatatcagatgaagtagaccaaagatttgttataaacataaacgaagaattcccagaagaacaagctaaagttcttaaagctgaagttggagatggaatgtggcaagttgtaaaaatcccaaccatagtatccagaacctgtgatggtggtaccacatcccgatggtctgctatgcagatcggtatgtccatgatttctgcttacaaacaagcagcaggggaagccgctactggtgacttcgcttacgctgcaaaacacgcagaagttgtacatatgggtacatacctaccagttagaagagcaagaggagaaaacgaacctggtggaattgcattcggtttcttagctgatatatgtcaatcaagcagagtaaatatggacgacccagttcgtgtagctctagatgttgtagcatctggtgcaatgttatacgaccaaatctggctcggatcatacatgtctggtggtgtaggattcacacaatatgctaccgcagcatacaccgacaacattcttgacgacttcacctactatggtaaagaatacgtcgaagacaaattcggattatgtgaagcacctaacaacatggacaccgtgttagatgtggcatcagaagtaacattctatggcctagaacaatacgaagaatacccagcactcttagaaacacagttcggtggatcacaaagagcagctgtagctgctgctgctgctgcatgttcaactggatttgctactggtaacgcacaaactgcgttaagcggttggtatttatccatgtacttgcacaaagaacaacactccagactcggtttctatggatacgaccttcaagatcagtgtggtgcatccaacgtattctcaattagaggagatgaaggactaccactagaacttagaggagcaaactaccccaactat

>Methanobacterium palustre, mcrA
gttctgggatgatattcgaagaactgttgttgtgggattaaacacagcacacactgttatagaaaaaaggttaggtaaagaagtaacccctgaaaccataacccactacctggaaactgtaaaccacgctatgcctggtgcagcagttgtccaagaacacatggtggaaacccaccctctactaactgccgacagttacgttaaagtgttcactggtaatgatgaaattgctgatgaaattgaccagagatacgtccttaacatcaacaaagagttcccagaacaccaagctgatgtcttaaaagcagaagtaggggacggaatgtggactattgtacggataccaaccattgtatcccgtacctgtgatggtggtaccacctcacgatggtctgcaatgcaagtgggtatgtcaatgatttctgcatacaaacaagctgcaggagaagccgctaccggtgacttcgcatacgcagctaaacacgcagaagttatacacatgggtacttacctacctgtaagaagagctcgaggggaaaacgaacctggaggaatcgccttcggttacttagcagacatctgtcagtcctcacgtgttaactgggaagaccctgtacgggttaccctggacgtggtggcttccggagctatgctatacgaccagatttggctaggttcctacatgtccggtggtgtcggattcactcagtacgctaccgcagcatacactgatgatattctagatgactttacctacttcggtaaagaatatgtggaagataaatacggaatgtgcgaagcacctaacaacatggacacagtccttgatgtagcttccgaagtaaccttctacgctctagaacagttcgaagactacccagcattactggaaaccatctttggtggatctcagagagcatccattgttgcagcagcagcaggatgttcaactgcattcgccactgctaatgctcagaccggtctaagtggatggtatttatccatgtacttacacaaagaacagcacagcagacttggtttctatggttacgacttgcaggaccagygtggtgcatccaacgtgttctcaatcaggaacgacgaaggattaccaactgaactgagaggagctaa