MethaGramPredictor

Predicts culturing conditions of methanogens using random forests and n-gram analysis. It was build using data from PhyMet2, a database of the methanogenic bacteria.

Usage: upload the mcrA gene sequence of an unknown methanogen and press “Submit” button. The results are predicted culturing conditions. For more information consult the manual.

Restrictions:

  • Be patient - calculations can take up to few minutes.

Author: Michal Burdukiewicz.

Example sequences:

>AY289748.1 Methanothermobacter wolfeii strain DSM 2970 methyl-coenzyme M reductase I alpha subunit (mcrA) gene, partial cds
GGTGGTGTAGGATTCACCCAGTACGCAACAGCAGCCTACACAGACAACATCCTCGACGACTTCACCTACT
TCGGTAAGGAGTACGTGGAGGACAAATATGGACTCTGTGAGGCACCAAACACCATGGACACAGTCCTGGA
CGTTGCGAGTGAGGTCACATTCTACGGACTTGAACAGTACGAGGAATACCCTGCACTCCTCGAAGACCAG
TTTGGTGGATCCCAGAGGGCCGCAGTCGTTGCAGCTGCAGCTGGATGTTCCACAGCCTTCGCAACAGCAA
ATGCCCAGACAGGTCTCAGCGGATGGTACCTCTCAATGTACCTGCACAAGGAGCAGCACTCCAGGCTCGG
ATTCTACGGTTACGACCTCCAGGACCAGTGTGGTGCATCCAACGTCTTCTCAATAAGGGGCGACGAGGGA
CTGCCACTGGAGCTTCGTGG

>AY970349.1 Methanosaeta harundinacea strain 6Ac methyl CoM reductase a subunit (mcrA) gene, partial cds
ACGTTCATGGCGTAGTTCGGATAGTTCGCGCCTCTCAGCTCGAGGGGGCTCCCCTCGTCGCCCTGGTAGC
TGAAGACGTTGGTCGGACCGCACTGGTCCTGCAGGTCGTATCCGAAGAAGCCCATCCTGCCCCAGCCGTC
CTTGTGGATGAGGTGGCTGAGGTACCAGGCGGCGAGGCCGGACTGGCTGTTTCCGGTCAGGCAGGCAGAG
CCGATGGCGCTGGCGGCGGCCATGACCGCGGACCTCTGGGAACCGCCGAAGTGGTCCTCCAGCAGGGTCG
GGAAGGACTCGTACTGCTCCATGGCGTAGAGGGTCGTCTCGGTGGCGATGTCCTTGGAGGTCTCCAGGGT
GGCGGGAGCCTTGCCCCAGTCACCGAACTTGTCCACGCCGTAGTCGCATGCGTAGTAGGAGAAGTCGTCC
AGGACGTCGTTGGTGTAGGCGGCCGTGGCGTACTGGGTGAAGCCGACACCACCGGACATGTAGCTGCCGA
GCCAAATCTGATCATAA